Effectiveness of VSV vectored SARS-CoV-2 spike when administered through intranasal, intramuscular or a combination of both – Scientific Reports

Date:

Cells and viruses

HEK293T (Dharmacon, Horizon Discovery, Cambridge, UK), Vero (CCL-81, ATCC), and Vero-TMPRSS2 were maintained in incubators at 34 °C or 37 °C and 5% CO2 (depending on the experiment). Cells were maintained in growth media (DMEM supplemented with 1X non-essential amino acids, 1 mM sodium pyruvate, and 10% fetal bovine serum (FBS) was used to maintain the cells). Vero-TMPRSS2 was generated by transduction with lentiviruses generated from vector pLEX307-TMPRSS2-G418 (Addgene plasmid # 158459) and maintained in growth media with G418 (Cat # 15710064, Gibco).

Vesicular stomatitis virus Indiana strain (VSV-WT) was obtained from ATCC (VR-1238). The virus aliquot was amplified on Vero CCL81 cells with infection media (DMEM supplemented with 1X non-essential amino acid, 1 mM sodium pyruvate, and 0.1% bovine serum albumin, 100 Units/mL penicillin, and 100 ug/mL streptomycin). VSV-WT stock was produced by infecting Vero cells at MOI = 0.01. Supernatant was collected at 3 days post infection (dpi), passed through a 0.22 µm filter, and tittered by plaque assay. SARS-CoV-2 variants of concern (VOC) used in hamster challenge study were obtained from BEI Resources: Alpha (hCoV-19/England/204820464/2020, NR-54971) and Delta (B.1.617.2/hCoV-19/USA/MD-HP05647/2021, NR-55672). Each SARS-CoV-2 strain was initially amplified on Vero E6 and titered on Vero cells. Sanger sequencing of S gene confirmed genetic identity to original isolate. All in vivo studies used Delta at passage 3 and Alpha at passage 4.

VSV-S2 virus generation, rescue, and amplification

Human codon optimized SARS-CoV-2 Spike (Ancestral 2019-nCoV/USA-WA1/2020, GenBank MN985325.1) with 21 deletion in the C-terminus (S2-Δ21) was synthesized by GeneArt (Thermofisher). S2-∆21 was inserted into the VSV-ΔGFP plasmid expression vector (Cat # EH1003, Kerafast Inc). Recombinant VSV-S2 (rVSV-S2) was packaged in HEK293T cells as briefly described: 5 × 106 HEK293T cells were transduced with lentiviral particles expressing T7 polymerase for 24 h, followed by transfection with 10 µg VSV-S2 expression vector and 5 μg of helper expression plasmids VSV-N, VSV-P, VSV-L, and VSV-G (Addgene 64087, 64088, 64085, 8454, respectively). Transfection was done using DharmaFECT kb DNA transfection regents (Cat# T-2006-05, Horizon Discovery). The transfected cells were incubated at 34 °C and supernatant was harvest at 72 h post-transfection and passed through 0.22 μm filter. Rescued virus was amplified in Vero-TMPRSS2 cells with helper plasmid expressing S2-Δ21 for one passage, followed by 5 subsequent rounds of amplification in Vero-TMPRSS2 in absence of helper S2-Δ21 expressing plasmid at MOI 0.1. Passaged 6 rVSV-S2 stocks were titered by plaque assay on Vero-TMPRSS2 cells and used for all subsequent in vitro and in vivo analysis.

Western blot

Incorporation of SARS-CoV-2 spike into rVSV-S2 was confirmed by western plot. VSV-S2 and VSV-WT viruses were harvested from passage 5 of viral amplification on Vero-TMPRSS2 cells. Cells were infected with VSV-S2 or VSV-WT at an MOI = 0.1 in a 100 mm tissue culture dish. 48 h post-infection VSV-S2 or VSV-WT virus particles were pelleted by ultracentrifugation for 2 h, 35,000 RPM, at 4 °C. Viral pellets were lysed in 4X Laemmli buffer. Lysates were run on 10% SDS–polyacrylamide gel and transferred onto polyvinylidene difluoride (PVDF) membrane. Membrane blots were blocked in 5% skim milk/TBST (Tris-buffered saline with 0.1% Tween 20 (Cat# 194841, MP BioMedicals)) for 1 h at room temperature, followed by detection with primary antibodies mouse anti-S1 antibody (Cat# MAB105403, R&D systems), mouse anti VSV-N (Cat # MABF2348, Sigma Aldrich), or mouse anti-VSV-G (Cat #MABF2321, Sigma Aldrich). Blots were then treated with secondary rabbit anti-mouse IgG-HRP (Cat#610-4302, Rockland) and developed with enhanced chemiluminescence (ECL) reagents (catalog number NEL105001EA; PerkinElmer). Blot was imaged on Bio-Rad ChemiDoc XRS + imaging system with parameters “Chemiluminescence, High Resolution.” Exposure times are indicated in figure legends.

Animal study

All animals used in this study were maintained at the small animal facility of the National Research Council Canada (NRC) in accordance with the guidelines of the Canadian Council on Animal Care. All procedures performed on animals in this study were in accordance with regulations and guidelines reviewed and approved in animal use protocol 2020.06 by the NRC Human Health Therapeutics Animal Care Committee. All experiments were conducted in accordance with relevant guidelines and regulations, including the ARRIVE guidelines.

To determine humoral and cell-mediated immune response to VSV-S2, a total of 70 female hACE2-KI mice between 6–7 weeks old (Jackson Laboratory, strain 035,000) were randomly divided into 8 vaccination groups (n = 10 for VSV-S2, n = 5 for VSV-WT control). On day 0 (D0), animals lightly anaesthetized with isoflurane then vaccinated either IM or IN (as indicated) with VSV-S2 or VSV-WT at 1 × 106 PFU per animal. Groups receiving 2 vaccination doses were given boosters on D21. Animals were euthanized D35 and tissues collected to assess immunogenicity. Serum was collected on D-2 (prebleed), D20 and D35 post-vaccination.

Animal challenge study was conducted with a total of 85 male Golden Syrian hamsters (81–90 g, 6–7 weeks old; Charles River Laboratory). Hamsters were randomly divided into 14 vaccination groups (n = 6 for VSV-S2, n = 5 for VSV-WT control). For the aged cohort, a total of 14 hamsters were used (12–18 months old), randomly divided into 2 groups (n = 7). On D0, hamsters lightly anaesthetized with isoflurane then vaccinated with VSV-S2 or VSV-WT via IM or IN route at 1 × 106 PFU per animal. Animals receiving 2 vaccination doses, received the booster on D28 by IM or IN. Serum was collected on D-2 (prebleed), D27, and D55. Immunized hamsters were divided into two groups on D56. Animals were anesthetized by injection of Ketamine/Xylazine (90 kg/mg/8 kg/mg) and intranasally challenged with either SARS-Cov-2 Alpha (hCoV-19/England/204820464/2020, B.1.1.7) or Delta (hCoV-19/USA/MD-HP05647/2021, B.1.617.2) at 8.5 × 104 PFU per animal. Weight and clinical symptoms were monitored daily. Animals were humanely euthanized by CO2 five days-post infection (dpi) and tissues immediately collected for subsequent analysis.

Anti-spike IgG and IgA ELISA

Total Spike-specific IgG titers in the serum and bronchoalveolar lavage (BAL) were quantified by ELISA. Briefly, 96-well high binding ELISA plates were coated overnight at room temperature with 100 µL of 0.3 µg/mL resistin-trimerized Spike (SmT1) protein diluted in PBS. After washing plates with PBS/0.05% Tween20 (PBS-T; Sigma-Aldrich, St. Louis, MO, USA), wells were blocked for 1 h at 37 °C with 200 µL 10% fetal bovine serum (Thermo Fisher Scientific) in PBS. Serum samples were serially diluted 3.162-fold and added to the plates to allow for binding of antibodies to the protein for 1 h at 37 °C. Bound IgG was incubated with goat anti-mouse IgG-HRP (1:4000, Southern Biotech, Birmingham, AL, USA) for 1 h at 37 °C prior to washing plates 5 times with PBS-T and adding 100 µL o-phenylenediamine dihydrochloride substrate (Sigma-Aldrich). After incubating for 30-min at room temperature while protected from light, 50 µL stop solution (4 N H2SO4) was added to each well. Bound IgG Abs were detected at 450 nm using the FilterMax F5 microplate reader (Molecular Devices, San Jose, USA). Anti-Spike IgG titers in the serum were defined as the dilution that resulted in an absorbance value (OD450) of 0.2 and were calculated using XLfit software (ID Business Solutions, Guildford, UK). Samples that did not reach the target OD were assigned the value of the lowest tested dilution (i.e. 10) for analysis purposes. No detectable titers were measured in serum samples from negative control animals.

Total Spike-specific IgA titers in the serum and BAL were quantified by ELISA, as described previously23. Briefly, 96-well high binding ELISA plates were coated overnight at 4 °C with 100 µL of 0.8 µg/mL SmT1 protein diluted in PBS. Plates were washed five times with PBS-T, and then blocked for 2 h at 37 °C with 200 µL 3% Difco™ skim milk (BD) in PBS. Serum samples were serially diluted 3.162-fold and added to the plates to allow for binding of antibodies to the protein for 1 h at 37 °C. Bound IgA was incubated with goat anti-mouse IgA-HRP (1:10,000, Abcam, Cambridge, UK) for 45 min. at 37 °C prior to washing plates 5 times with PBS-T and adding 100 μL KPL SureBlue™ Tetramethylbenzidine (TMB) microwell peroxidase substrate (one-component) (Mandel Scientific Company Inc., Guelph, ON, Canada). The reaction was stopped by adding 100 μL KPL TMB Stop solution (Mandel Scientific Company Inc.) after a 10 min. incubation at room temperature while protected from light. Bound IgA Abs were detected at 450 nm, and IgA antibody titers were determined as above for IgG.

IFN-γ ELISpot

Total Spike-specific cell numbers were enumerated by ELISpot using a mouse IFN-γ kit (Mabtech Inc., Cincinnati, OH, USA). Splenocytes were stimulated with the PepMix™ SARS-CoV-2 Spike Glycoprotein peptide library (315 peptides; 15mers overlapping by 11 amino acids) (PM-WCPV-S-2; JPT Peptide Technologies GmbH, Berlin, Germany), which was split into 2 subpools (158 + 157 peptides). Each subpool was separately used to stimulate 4 × 105 cells in duplicate at a final concentration of 2 µg/mL per peptide. Cells incubated without any stimulants were used to measure background responses. Spot-forming cells (SFCs) were counted using an automated ELISpot plate reader (Cellular Technology LTD, Beachwood, OH, USA). For each animal, values obtained with media alone (background) were subtracted from those obtained with each of the Spike peptide pools, and then combined to yield an overall number of antigen-specific IFN-γ+ SFCs/106 splenocytes per animal.

RBD-specific IgG ELISA

RBD-specific IgG titers in collected serums were quantified using ELISA. Briefly, Nunc MaxiSorp flat-bottom 96 well plates were coated with SARS-CoV-2 RBD- His recombinant protein (40,595-V80H, Sino Biological, China) and incubated overnight at 4 °C. Following incubation, plates were washed with PBS containing 0.1% Tween-20 (PBS-T) and blocked with 3% Bovine Serum Albumin (IgG-Free). Fivefold serially diluted hamster serums were transferred to the plate and incubated for 1 h at 37 °C. Plates were then washed with PBS-T, and Peroxidase AffiniPure Goat Anti-Syrian Hamster IgG (H + L) (Cat # 107-035-142, Jackson Immuno Research, West Grove, USA) was added to each well and incubated at 37 °C for 1 h. After the last wash with PBS-T, 100 µL of TMB substrate (Cat# 7004P6, Cell Signaling Technology, MA, USA) was added to each well and incubated at room temperature for 2 min before 100 ul of TMB Stop solution (Cat# 7002P6, Cell Signaling Technology, MA, USA) was added. Absorbance was measured at 450 nm. Inhibitory dilution 50 (ID50) was calculated using non-linear regression analysis.

Plaque assay

Infectious viral load was quantified by plaque assay on homogenized lung and nasal turbinate tissues as previously described24. In brief, spin-clarified supernatants of tissue homogenates were serially diluted 1:10 in infection media (DMEM supplemented 1X non-essential amino acid, 1 mM sodium pyruvate, and 0.1% bovine serum albumin). Dilutions were adsorbed on Vero cells for 1 h at 37 °C/5% CO2. After adsorption, inoculum was removed and 1 ml of infection media with 0.6% ultrapure, low-melting point agarose was overlaid over the cell monolayer and incubated for 72 h. To visualize plaques, cells were fixed with 10% formaldehyde and stained with crystal violet. Plaques forming units (PFU) was determined per gram tissue.

Plaque reduction neutralization assay

The PRNT assay was performed in the NRC’s CL3 facility as previously described5. Serum samples were inactivated at 56 °C for 30 min and stored on ice. The inactivated serum was serially diluted 1-in-2 and incubated with equal volume of 100 PFU of SARS-CoV-2 at 37 °C for 1 h, followed by infection of Vero E6-ACE2-TMPRSS2 cells (NIBSC, Great Britain, cat# 101003). Adsorption of virus were carried out for 1 h at 37 °C. After adsorption, inoculum was removed and cells were overlaid with media as described above. The assay was incubated at 37 °C/5% CO2 for 72 h (or 96 h for BA.5 virus). Cells were fixed with 10% formaldehyde after incubation and stained with crystal violet. No serum, virus-only back-titer control was included along with naïve animal serum. PRNT50 is defined as the highest dilution of serum that results in 50% reduction of plaque-forming units. The 1-in-2 dilution of diluted serum to 100 PFU virus was included in the final calculation.

Real time quantitative-PCR

Viral RNA from hamster respiratory tissues including lung and nasal turbinate were extracted using Quick-viral RNA kit according to the manufactures (Cat #R1035, Zymo Research, Irvine, USA). Luna Universal One-step RT-qPCR kit was used to quantify viral genomic RNA (Cat #, E3005S, New England Biolabs, MA, USA) with primer/probe sets for the SARS-CoV-2 E gene25 (Forward: 5′ACAGGTACGTTAATAGTTAATAGCGT Reverse: 5′ ATATTGCAGCAGTACGCACACA Probe: ACACTAGCCATCCTTACTGCGCTTCG 5′Fam 3′QSY-1). Known concentrations of viral RNA copies were used to generate standards. 5 μL of extracted RNA were run in duplicate on Applied Biosystems StepOne Real time PCR (ThermoFisher Scientific, MA, USA) and results analyzed with StepOne Software.

Histology

The left lobes of infected hamster lungs were isolated and fixed in 10% formalin for 1 week at room temperature. Fixed tissues were transferred into 70% ethanol, then processed and embedded in paraffin wax. The paraffin block was cut into 4 µm sections and placed on Superfrost Plus slides (Fisher Scientific). Sections were dried, and duplicate sections were subjected to hematoxylin and Eosin (H&E) or immunohistochemical (IHC) staining. H&E staining was done on a fully automated Leica ST5010-CV5030 system; SARS-CoV-2 nucleocapsid was detected with mouse anti-SARS-CoV-2 nucleocapsid monoclonal antibody (1:5000, R&D System MAB10474) on the Bond-Max III fully automated staining system (Leica Biosystems, Wetzlar) with a modified F protocol and Bond Polymer Refine Detection. Following deparaffinization and rehydration, sections were pre-treated with the Epitope Retrieval Solution 1 (ER1, Citrate buffer, pH 5.0) at 98 °C for 20 min. After washes, non-specific endogenous peroxidases were quenched using peroxidase block for 5 min. Sections were washed again and then incubated for 15 min at room temperature with primary antibodies. Sections were washed again and incubated with polymer refine for 8 min at room temperature and developed with 3, 3’-diaminobenzidine (DAB) chromogen for 10 min. After final wash sections were counterstained with hematoxylin for 5 min, dehydrated, cleared, and mounted. Negative controls included omission of primary antibody and incubation with secondary antibody alone as well as lung tissue from naïve animals.

Stained slides were scanned at 20 × magnification using a Zeiss Axio Scan.Z1 digital slide scanner capable of brightfield imaging, and analysed on QuPath 0.3.2 (https://qupath.github.io)26. Briefly, images were then set to brightfield (H-DAB), and immunopositive (stained with hematoxylin and DAB) and negative cells (stained with hematoxylin only) were selected. Immunopositive cells were determined with in-software function analyze_cell detection_positive cell detection_run. Values were then exported into an excel file and the data therein was used for graphing results. Parameters for optimal cell detection and analysis such as threshold value etc. were determined beforehand for each antibody stain and those values were kept constant for all sections.

Statistical analysis

Data were analyzed using GraphPad Prism 9 (GraphPad Software, Boston, MA, USA). Statistical significance of the difference among groups was determined through one-way analysis of variance (ANOVA) or two- way ANOVA (as indicated in the figure legend) with Tukey’s multiple comparison test (comparison across all groups). ELISA and ELISpot data were log-transformed prior to statistical analysis. Significant differences were considered with p < 0.05. Statistical significance was indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.

Share post:

Popular

More like this
Related

7 continents in 4 months: Holland America Line reveals 2026 world cruise

If visiting all seven continents is on your travel...

SDC Championship Tips 2024 – Golf Betting System

Course Overview. St Francis Links is a...

West Ham vs Brentford predictions: Premier League tips and odds

Our betting expert has three West Ham United vs...